Evaluation of Cetyltrimethylammonium Bromide and Sodium Dodecyl Sulfate in the Extraction of Nucleic Acid in Common Culinary and Herbal Vegetables

Anthony D. VanHoy Humber College Institute of Technology and Advanced Learning Department of Mathematics, Research Skills, and Analysis July 2023
Abstract

We investigate Cetyltrimethylammonium Bromide and Sodium Dodecyl Sulfate as a safer alternative to Phenol/Chloroform extraction of Nucleic Acid. Much research has been completed on the use of these chemicals as individual extraction reagents. There is less study of the application of both in the same protocol. In cases where additional cleanup is needed, we use Dichloromethane (DCM), a common organic solvent.

Background

In general, successful and relatively pure nucleic acid extraction from plants is more difficult and commonly involves the use of very toxic chemicals in comparison to non-plant species. This difficulty is due to various characteristics of plant cells that, in some cases, do not exist in other eukaryotes. For example, plant cell walls contain rigid polysaccharides that often require physical maceration to break open. Additionally, the resulting suspension of tissue is separated into polar and non-polar components using toxic organic chemicals like Chloroform and/or Phenol which are both very toxic. Nucleic acid associates with water in the resulting two-phase mixture allowing for the removal of contaminants.

Our goal in this study is to evaluate Cetyltrimethylammonium Bromide (CTAB), Sodium Dodecyl Sulfate (SDS), and Dichloromethane (DCM) as a viable and safer alternative to Phenol and Chloroform for high quality nucleic acid extractions with common culinary vegetables and herbs. CTAB and SDS are surfactants that are soluble in water and alcohol. CTAB is cationic and readily dissolves polysaccharides. SDS is anionic and a protein denaturant. DCM is a common organic solvent used in organic chemistry with similar properties to Chloroform. DCM has a relative polarity of 0.309, Chloroform is 0.259, while water is 1.000. CTAB and SDS in combination have been studied for recalcitrant tropical species of plants (Barbier et al, 2019). DCM has been studied as a replacement for Chloroform across various plant species (Chaves et al, 1995). DCM will be used in cases where samples appear cloudy or contain significant color after initial treatment with CTAB and SDS.

In the agriculture sciences it is useful to have many alternative protocols for nucleic acid extraction. In this study we look at combining previously studied methods to give additional options to researchers in these fields. In some cases, the substitution of reagents and/or change in concentration can improve cleanup or change the yield of nucleic acid.

Materials and Methods

Tissue samples were collected from various common vegetables purchased in local stores in Ontario, Canada. Vegetables were washed before use and stored at 4ºC until processed. A small amount of tissue was collected from each as follows:

• Small Yellow Onion (Allium flavum) – an inner layer is removed and cut into small pieces.
• Orange Pepper (Capsicum annuum) – scrapings from the inside portion of the exocarp.
• Garlic (Allium sativum) – a portion is cut into small pieces after removal of the outer and inner peel.
• Spinach Leaf (Spinacia oleracea) – cut up whole leaves into small pieces, stems removed.
• Thyme (Thymus vulgaris) – a few petals are plucked from the stem.
• Wheat Germ (Triticum vulgare) – pre-processed and in a roughly powdered form.
• Broccoli (Brassica oleracea) – a few buds scraped from florets.

Reagent list:

• CTAB buffer: CTAB 2% (w/v), NaCl 1.4 M, Ethylenediaminetetraacetic acid (EDTA) 20 mM, Tris (hydroxymethyl) aminomethane (Tris-HCl) 100 mM, Polyvinylpyrrolidone-30k (PVP) 2% (w/v) – added just before use.
• DCM
• Ethanol 70%
• Isopropanol 99.9%
• Molecular Biology Grade Water
• PCR Master Mix (with Taq polymerase and dNTP’s)
• PCR Primers (rbcL gene)
• Forward: ATGTCACCACAAACAGAGACTAAAGC
• Reverse: CGTTCACCTTCTAGTTTACCTACAACAGT
• Proteinase K
• SDS 10% (w/v)
• Sterilized Sand

Extraction Protocol:

Initially, all samples are ground with a stainless-steel mortar and pestle. Before samples are ground, approximately 20-30 mg of sterile sand is placed in the mortar. Samples are then added to the mortar with 1 mL of pre-warmed (to 60ºC) CTAB buffer. Samples are then ground until a homogeneous suspension is achieved.

1. Transfer 40-50 mg of sample into 2 mL tubes. Each tube is labeled.
2. Add 20 µL of Proteinase K, shake briefly, and pulse centrifuge.
3. Add 600 µL of CTAB buffer. Agitate by shaking briefly and incubate at 37ºC for 20 minutes. Shake the tubes after 10 minutes. Note that longer incubation may be needed for some species.
4. Add 30 µL SDS buffer and shake briefly. Incubate at 37ºC for 5 minutes and centrifuge at 16,000 g for 15 minutes.
5. Remove as much of the fluid as possible using a micropipette to a new 1.5 mL tube. Care must be taken here to avoid drawing up contaminants. If contaminants are transferred, re-spin tubes at 16,000 g for 5 minutes and repeat the fluid transfer. Continue to item 8 if fluid is clear and colorless.

Additional steps if transferred fluid is not relatively clear and colorless:

6. Add 1 volume of DCM, shake well to mix and incubate at room temperature for 5 minutes. Centrifuge at 16,000 g for 5 minutes.
7. Carefully remove the top aqueous phase to a new 1.5 mL tube. Observe that the aqueous phase should be clear while the bottom organic layer will still have color. In our experience best results were achieved by leaving a small layer of aqueous phase just above the interphase.

8. Add 1 volume of 100% isopropanol and tip tubes several times. At this stage the protocol can be paused for a period of several days if needed. Samples should be incubated at 4ºC. If continuing, tubes are incubated at room temperature for 20 minutes.
9. Centrifuge at 16,000 g for 5 minutes. Carefully discard fluid observing a pellet on the bottom of the tube. Let the tubes air dry for up to 5 minutes. Take care not to let the pellet fall from the tube.
10. Add 1 mL of 70% Ethanol and slowly tip several times. Spin tubes briefly to concentrate pellet at bottom of tube. Discard Ethanol and allow the pellet to dry for up to 40 minutes.
11. Add 80-200 µL of pre-warmed (60ºC) Molecular Biology Grade Water depending on pellet size. Pellet should dissolve quickly.

After at least one hour, samples were analyzed with a Nanodrop ND-1000 Spectrophotometer (Thermo Fisher Scientific®)

PCR Protocol:

Sometime after the extraction is complete PCR amplification is performed to evaluate the extraction for downstream applications. The gene chosen for amplification is the rbcL gene common in all plants and many fungi (Newmaster et al, 2006). Primers were chosen (Hasebe et al, 1994). PCR was performed using a Bio-Rad® thermal cycler. To a 200 µL PCR tube we:

1. Add 4 µL of Master Mix.
2. Add 10 µL of molecular biology grade water.
3. Add 2 µL of primer mix.
4. Add 4 µL of each sample of raw genomic DNA template. No genomic DNA will be added to a PCR control.
5. Run the following program on the thermal cycler:
1. 1 x 15 mins at 95°C
2. 35 x:
1. 30 secs at 94°C
2. 45 secs at 56°C
3. 45 secs at 72°C
3. 1 x 5 mins at 72°C
4. ∞ at 15°C

Next, PCR raw gDNA samples and PCR products are run through agarose gel electrophoresis. This was performed using a standard mini-gel box at 50 V for 60 minutes. Tris/Borate/EDTA (TBE) was used to create a 1.5% agarose gel and electrolyte. GelRed (Biotium®) was used as a gel stain.

Results and Discussion

The table below indicates the following: inclusion of DCM steps in the protocol, average spectrophotometry results, and gel image result. There are 3 spectrophotometry results: A₂₆₀:A₂₃₀, A₂₆₀:A₂₈₀, and ng/µL, where A_n represents the absorption at a wavelength of n nanometers and the final value represents the concentration of nucleic acid in nanograms per micro-litre as measured by the spectrophotometer. Gel image lanes are assigned as: lane 1 – 100 bp ladder, lane 2 – PCR control, lane 3 – sample 1 amplicon, lane 4 – sample 2 amplicon, lane 5 – sample 3 amplicon, lane 6 – sample 4 amplicon, lane 7 – sample 1 template gDNA, lane 8 – sample 2 template gDNA, lane 9 – sample 3 template gDNA, lane 10 – sample 4 template gDNA, lane 11 – 1 kbp ladder.

Table 1:

As can be seen from the table, the protocol performance is consistent except for garlic which resulted in only 2 out of 4 amplified samples. This could be due to residual PCR inhibitors such as polyphenol. It has been reported that 2-Mercaptoethanol may be used to reduce this inhibitor (Sahu, Thangaraj, & Kathiresan, 2012).

Conclusions

The CTAB/SDS protocol used above has been shown to be generally successful for the herbs and culinary vegetables tested. Spectrophotometry ratios indicate many pure nucleic acid extractions, although some may benefit from further cleanup as interference may be at an increased risk with some downstream applications. Samples with lower A₂₆₀:A₂₃₀ ratios may benefit from further evaluation with 2-Mercaptoethanol, Dithiothreitol (DTT), or another reducing agent.

References

1. Barbier F.F., Chabikwa T.G., Ahsan M.U., Cook S.E., Powell R., Tanurdzic M., Beveridge C.A. (2019). A phenol/chloroform-free method to extract nucleic acids from recalcitrant, woody tropical species for gene expression and sequencing. Plant Methods. 1-13.
2. Chaves, A.L., Vergara, C.E. & Mayer, J.E. Dichloromethane as an economic alternative to chloroform in the extraction of DNA from plant tissues. Plant Mol Biol Rep 13, 18–25 (1995).
3. Hasebe, M., Wolf, P. G., Pryer, K. M., Ueda, K., Ito, M., Sano, R., Gastony, G. J., Yokoyama, J., Manhart, J. R., Murakami, N., Crane, E. H., Haufler, C. H., & Hauk, W. D. 1995. Fern Phylogeny Based on rbcL Nucleotide Sequences. American Fern Journal, 85(4), 134–181. https://doi.org/10.2307/1547807
4. Newmaster S.G., Fazekas A.J., and Ragupathy S. 2006. DNA barcoding in land plants: evaluation of rbcL in a multigene tiered approach. Canadian Journal of Botany. 84(3): 335-341. https://doi.org/10.1139/b06-047
5. Sahu S.K., Thangaraj M., Kathiresan K. (2012). DNA Extraction Protocol for Plants with High Levels of Secondary Metabolites and Polysaccharides without Using Liquid Nitrogen and Phenol. ISRN Mol Biol. 205049.